circad | circRNAs associated with diseases
  circRNA.2837
 Genen/aOrganismRat
 Genome Locusn/aBuildn/a
 DiseaseSciatic Nerve injuryICD-10 Injury of nerve(s) of unspecified body region (T14.4)
 DBLinkLink to databasePMID30098504
 Experimental Method
 Sample TypeSciatic nervesComparisoninjured nerve tissues compared with matched normal tissues
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)		Forward

GATCCCAGCTCTTTCACCCG

Reverse

CAACCAGCUAAGACACUGCGAAA

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Zhou, ZB, Niu, YL, Huang, GX, Lu, JJ, Chen, A, Zhu, L (2018). Silencing of circRNA.2837 Plays a Protective Role in Sciatic Nerve Injury by Sponging the miR-34 Family via Regulating Neuronal Autophagy. Mol Ther Nucleic Acids, 12:718-729.